Journal: bioRxiv

Article Title: Systematic functional dissection of germline noncoding risk variants impacting clonal hematopoiesis

doi: 10.64898/2026.01.21.700897

Figure Lengend Snippet: (A) Schematic of lentiviral MSI2 overexpression constructs and Western blot confirming MSI2 overexpression in K562 cells. (B) Setup of MSI2 overexpression experiments in murine Tet2 -/- hematopoietic stem and progenitor cells (HSPCs). (C) Colony replating assays of sorted GFP + Lin - Sca-1 + c-Kit + (LSK) cells shows increased self-renewal of Tet2 -/- HSPCs upon MSI2 upregulation. (D) Venn diagram showing common and unique differentially expressed genes across different genotypes identified by RNA-Seq (FDR <0.05 and |log2FC| >1.5). “WT MSI2” indicates wild-type HSPCs transduced with MSI2 overexpressing vector; “Tet2 -/- MSI2” indicates Tet2 -/- HSPCs transduced with MSI2 overexpressing vector; “Tet2 -/- HMD” indicates Tet2 -/- HSPCs transduced with empty HMD vector. All groups are compared against WT HSPCs transduced with empty HMD vector, “WT HMD” (n=2 replicates each group). (E) Heatmap showing relative expression of Wnt polarity genes across all groups. (F) Heatmap showing relative expression of Cell cycle genes across groups. (G) Gene set enrichment analysis of MSI2 HyperTRIBE binding targets in Tet2 -/- MSI2 vs. WT HMD. All data are means ± SDs. *p < 0.05, **p < 0.01.

Article Snippet: Bulk RNA-seq was performed in two biological replicates using primary HSPCs (LSK cells) isolated from a well-established TET2 mouse model. Total RNA was extracted using the RNeasy Mini Kit, and poly(A) enrichment and library preparation were carried out with the NEBNext Ultra II Directional RNA Library Prep Kit.

Techniques: Over Expression, Construct, Western Blot, RNA Sequencing, Transduction, Plasmid Preparation, Expressing, Binding Assay

Journal: bioRxiv

Article Title: Systematic functional dissection of germline noncoding risk variants impacting clonal hematopoiesis

doi: 10.64898/2026.01.21.700897

Figure Lengend Snippet: (A) CFU-C replating assay shows the colonies number from sorted murine GFP+ TET2+/- HSPCs. (B-C) Colony images of 2 nd plating from TET2+/- and TET2-/-HSPCs, respectively. (D) Heatmap showing expression of genes across all genotypes highlighting genes uniquely up- and down-regulated in the KO HMD group (E) Heatmap represents mitochondrial electron transport chain genes expression in different experimental groups. (F) Volcano plots show DEGs expression compared WT MSI2 vs WT HMD, Tet2-/- HMD vs WT HMD, Tet2-/- MSI2 vs Tet2-/- HMD, and Tet2-/- MSI2 vs WT HMD. (G) Gene ontology analysis of downregulated and upregulated pathways between Tet2 -/- MSI2 vs. WT HMD.

Article Snippet: Bulk RNA-seq was performed in two biological replicates using primary HSPCs (LSK cells) isolated from a well-established TET2 mouse model. Total RNA was extracted using the RNeasy Mini Kit, and poly(A) enrichment and library preparation were carried out with the NEBNext Ultra II Directional RNA Library Prep Kit.

Techniques: Expressing

Journal: Cell reports

Article Title: The Zscan4-Tet2 Transcription Nexus Regulates Metabolic Rewiring and Enhances Proteostasis to Promote Reprogramming.

doi: 10.1016/j.celrep.2020.107877

Figure Lengend Snippet: Figure 1. TET2 Physically Interacts with Multiple SCAN Domain Proteins (A) A mammalian two-hybrid system and dual-luciferase reporter system to search for TET2-interacting proteins. Human full-length (FL) TET2 fused to VP16 transactivation domain (AD), preys fused to Gal4 DNA-binding domain (DBD), UAS-luciferase reporter plasmid, and CMV-Renilla control plasmid were

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Tet2 for western-blot and chromatin immunoprecipitation CST Cat#92529 TET2 for immunoprecipitation YouKe Biotechnology Immunogen: 1-232 aa of TET2 TET2 for western-blot Abclonal Cat#A1526 Flag tag Shanghai Genomics Technology Cat#4110-20 Myc tag HuaAn Biological Technology Cat#R1208-1 HA tag HuaAn Biological Technology Cat#ET1611-49 Gal4 Santa Cruz Cat#sc-510 5hmC Active Motif Cat#39769 5mC Active Motif Cat#39649 Slc2a3 Proteintech Cat#20403-1-AP Pkm CST Cat#4053T SSEA-1 R&D Cat#MAB2155 Rpn1 (PSMD2) Santa Cruz Cat#sc-271775 Rpn2 (PSMD1) Santa Cruz Cat#sc-166038 Rpn9 (PSMD13) Abclone Cat#A6956 Rpn10 (PSMD4) CST Cat#12441S Rpn11 (PSMD14) CST Cat#7662S Rpt3 (PSMC4) Enzo Cat#BML-PW8765 PSMA7 Abcam Cat#ab109378 PSMB5 CST Cat#12919S 20S Enzo Cat#BML-PW8195 g-tubulin Sigma Cat#T5326 b-actin Genscript Cat#A00702 Flag-beads Sigma Cat#A2220 Chemicals, Peptides, and Recombinant Proteins Lipofectamine 2000 Invitrogen Cat# 11668019 MG-132 MCE Cat#HY-13259 BTZ (Bortezomib) MCE Cat# HY-10227 Deposited Data Raw imaging data This paper https://data.mendeley.com/datasets/3d4zdm6bh7/9/ files/9fe70da6-6f9e-418a-9cc8-7b04756f5d7d/source %20data%2020200509.ppt?dl=1 Raw and analyzed data This paper GEO: GSE140239 Experimental Models: Cell Lines

Techniques: Luciferase, Binding Assay, Plasmid Preparation, Control

Journal: Cell reports

Article Title: The Zscan4-Tet2 Transcription Nexus Regulates Metabolic Rewiring and Enhances Proteostasis to Promote Reprogramming.

doi: 10.1016/j.celrep.2020.107877

Figure Lengend Snippet: Figure 3. Zscan4f Upregulates Proteasome and Metabolism Genes in a Tet2-Interaction-Dependent Manner (A) Genomic distribution of FLAG-Zscan4f binding sites in D4-OSKM-2ndMEFs, as determined by ChIP-seq (left). Immunoglobulin G (IgG) was included as a negative control. FLAG-Zscan4f binding peaks are around TSS regions (right). (B) An octanucleotide motif (CCGCSGCB) as the putative Zscan4f-binding DNA sequence, determined by ChIP-seq (top). In vitro EMSA assay was conducted to compare the DNA binding activity of Zscan4f, Zscan4f3A, and Zscan4fN155, and competitive EMSA with unlabeled competitor DNA (referred as cold probe) was also conducted to verify the DNA-binding specificity. (C) Superimposed fluorescence polarization plots for DNA-binding affinities of Zscan4f, Zscan4f3A, and Zscan4fN155. carboxyfluorescein (FAM)-labeled double-stranded DNA (dsDNA) (15 nM) was incubated with increasing amounts of indicated proteins for 30 min at 25C in reaction buffer. Fluorescence po- larization was measured by the Synergy 4 microplate reader (BioTek) at 25C, as described in the STAR Methods. Shown are average values of triplicated results with SEM. (legend continued on next page)

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Tet2 for western-blot and chromatin immunoprecipitation CST Cat#92529 TET2 for immunoprecipitation YouKe Biotechnology Immunogen: 1-232 aa of TET2 TET2 for western-blot Abclonal Cat#A1526 Flag tag Shanghai Genomics Technology Cat#4110-20 Myc tag HuaAn Biological Technology Cat#R1208-1 HA tag HuaAn Biological Technology Cat#ET1611-49 Gal4 Santa Cruz Cat#sc-510 5hmC Active Motif Cat#39769 5mC Active Motif Cat#39649 Slc2a3 Proteintech Cat#20403-1-AP Pkm CST Cat#4053T SSEA-1 R&D Cat#MAB2155 Rpn1 (PSMD2) Santa Cruz Cat#sc-271775 Rpn2 (PSMD1) Santa Cruz Cat#sc-166038 Rpn9 (PSMD13) Abclone Cat#A6956 Rpn10 (PSMD4) CST Cat#12441S Rpn11 (PSMD14) CST Cat#7662S Rpt3 (PSMC4) Enzo Cat#BML-PW8765 PSMA7 Abcam Cat#ab109378 PSMB5 CST Cat#12919S 20S Enzo Cat#BML-PW8195 g-tubulin Sigma Cat#T5326 b-actin Genscript Cat#A00702 Flag-beads Sigma Cat#A2220 Chemicals, Peptides, and Recombinant Proteins Lipofectamine 2000 Invitrogen Cat# 11668019 MG-132 MCE Cat#HY-13259 BTZ (Bortezomib) MCE Cat# HY-10227 Deposited Data Raw imaging data This paper https://data.mendeley.com/datasets/3d4zdm6bh7/9/ files/9fe70da6-6f9e-418a-9cc8-7b04756f5d7d/source %20data%2020200509.ppt?dl=1 Raw and analyzed data This paper GEO: GSE140239 Experimental Models: Cell Lines

Techniques: Binding Assay, ChIP-sequencing, Negative Control, Sequencing, In Vitro, Activity Assay, Labeling, Incubation, Fluorescence

Journal: Cell reports

Article Title: The Zscan4-Tet2 Transcription Nexus Regulates Metabolic Rewiring and Enhances Proteostasis to Promote Reprogramming.

doi: 10.1016/j.celrep.2020.107877

Figure Lengend Snippet: Figure 4. Zscan4f Upregulates Genes Involved in Glucose Metabolism in a Tet2-Interaction-Dependent Manner (A) Zscan4f, but not the Zscan4f3A mutant, guides Tet2 to facilitate DNA demethylation at the promoter regions of Slc2a3 and Pkm in D4-OSKM-2ndMEFs, as determined by ChIP-qPCR and hMeDIP-qPCR. IgGs were included as negative controls for ChIP-qPCR. Arrow denotes promoter orientation, and CGI (gray line) indicates CpG islands containing Zscan4f-binding motif. (B) Forced expression of wild-type Zscan4f, but not the Zscan4f3A mutant, upregulates the mRNA expressions of Slc2a3 and Pkm in D4-OSKM-2ndMEFs, as determined by qRT-PCR.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Tet2 for western-blot and chromatin immunoprecipitation CST Cat#92529 TET2 for immunoprecipitation YouKe Biotechnology Immunogen: 1-232 aa of TET2 TET2 for western-blot Abclonal Cat#A1526 Flag tag Shanghai Genomics Technology Cat#4110-20 Myc tag HuaAn Biological Technology Cat#R1208-1 HA tag HuaAn Biological Technology Cat#ET1611-49 Gal4 Santa Cruz Cat#sc-510 5hmC Active Motif Cat#39769 5mC Active Motif Cat#39649 Slc2a3 Proteintech Cat#20403-1-AP Pkm CST Cat#4053T SSEA-1 R&D Cat#MAB2155 Rpn1 (PSMD2) Santa Cruz Cat#sc-271775 Rpn2 (PSMD1) Santa Cruz Cat#sc-166038 Rpn9 (PSMD13) Abclone Cat#A6956 Rpn10 (PSMD4) CST Cat#12441S Rpn11 (PSMD14) CST Cat#7662S Rpt3 (PSMC4) Enzo Cat#BML-PW8765 PSMA7 Abcam Cat#ab109378 PSMB5 CST Cat#12919S 20S Enzo Cat#BML-PW8195 g-tubulin Sigma Cat#T5326 b-actin Genscript Cat#A00702 Flag-beads Sigma Cat#A2220 Chemicals, Peptides, and Recombinant Proteins Lipofectamine 2000 Invitrogen Cat# 11668019 MG-132 MCE Cat#HY-13259 BTZ (Bortezomib) MCE Cat# HY-10227 Deposited Data Raw imaging data This paper https://data.mendeley.com/datasets/3d4zdm6bh7/9/ files/9fe70da6-6f9e-418a-9cc8-7b04756f5d7d/source %20data%2020200509.ppt?dl=1 Raw and analyzed data This paper GEO: GSE140239 Experimental Models: Cell Lines

Techniques: Mutagenesis, ChIP-qPCR, Binding Assay, Expressing, Quantitative RT-PCR

Journal: Cell reports

Article Title: The Zscan4-Tet2 Transcription Nexus Regulates Metabolic Rewiring and Enhances Proteostasis to Promote Reprogramming.

doi: 10.1016/j.celrep.2020.107877

Figure Lengend Snippet: Figure 5. Zscan4f-Tet2 Interaction Increases Proteasome Expression and Function during Reprogramming (A) Zscan4f, but not the Zscan4f3A mutant, guides Tet2 to facilitate DNA demethylation at the promoter regions of Psma7 and Psmd13 in D4-OSKM-2ndMEFs, as determined by ChIP-qPCR and hMeDIP-qPCR. IgGs were included as negative controls for ChIP-qPCR. Arrow denotes promoter orientation, and tCGI (gray line) indicates CpG islands containing Zscan4f-binding motif.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Tet2 for western-blot and chromatin immunoprecipitation CST Cat#92529 TET2 for immunoprecipitation YouKe Biotechnology Immunogen: 1-232 aa of TET2 TET2 for western-blot Abclonal Cat#A1526 Flag tag Shanghai Genomics Technology Cat#4110-20 Myc tag HuaAn Biological Technology Cat#R1208-1 HA tag HuaAn Biological Technology Cat#ET1611-49 Gal4 Santa Cruz Cat#sc-510 5hmC Active Motif Cat#39769 5mC Active Motif Cat#39649 Slc2a3 Proteintech Cat#20403-1-AP Pkm CST Cat#4053T SSEA-1 R&D Cat#MAB2155 Rpn1 (PSMD2) Santa Cruz Cat#sc-271775 Rpn2 (PSMD1) Santa Cruz Cat#sc-166038 Rpn9 (PSMD13) Abclone Cat#A6956 Rpn10 (PSMD4) CST Cat#12441S Rpn11 (PSMD14) CST Cat#7662S Rpt3 (PSMC4) Enzo Cat#BML-PW8765 PSMA7 Abcam Cat#ab109378 PSMB5 CST Cat#12919S 20S Enzo Cat#BML-PW8195 g-tubulin Sigma Cat#T5326 b-actin Genscript Cat#A00702 Flag-beads Sigma Cat#A2220 Chemicals, Peptides, and Recombinant Proteins Lipofectamine 2000 Invitrogen Cat# 11668019 MG-132 MCE Cat#HY-13259 BTZ (Bortezomib) MCE Cat# HY-10227 Deposited Data Raw imaging data This paper https://data.mendeley.com/datasets/3d4zdm6bh7/9/ files/9fe70da6-6f9e-418a-9cc8-7b04756f5d7d/source %20data%2020200509.ppt?dl=1 Raw and analyzed data This paper GEO: GSE140239 Experimental Models: Cell Lines

Techniques: Expressing, Mutagenesis, ChIP-qPCR, Binding Assay

Journal: Cell reports

Article Title: The Zscan4-Tet2 Transcription Nexus Regulates Metabolic Rewiring and Enhances Proteostasis to Promote Reprogramming.

doi: 10.1016/j.celrep.2020.107877

Figure Lengend Snippet: Figure 6. ZSCAN4 Interacts with TET2 to Induce Proteasome and Glycolytic Genes (A) Structural features of human ZSCAN4 and truncated proteins (top). FLAG-TET2 was transiently co-expressed with Myc-tagged FL ZSCAN4 or truncations in HEK293T cells. The truncated proteins of ZSCAN4 include N (N-terminal 1–168 amino acid [aa], containing the SCAN-box) and C (C-terminal 169–433 aa). Protein-protein interaction was examined by IP-western using the indicated antibodies. (B) FLAG-TET2 was transiently co-expressed with the indicated HA-tagged wild-type or mutant ZSCAN4 in HEK293T cells. Protein-protein interaction was examined by IP-western using the indicated antibodies.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Tet2 for western-blot and chromatin immunoprecipitation CST Cat#92529 TET2 for immunoprecipitation YouKe Biotechnology Immunogen: 1-232 aa of TET2 TET2 for western-blot Abclonal Cat#A1526 Flag tag Shanghai Genomics Technology Cat#4110-20 Myc tag HuaAn Biological Technology Cat#R1208-1 HA tag HuaAn Biological Technology Cat#ET1611-49 Gal4 Santa Cruz Cat#sc-510 5hmC Active Motif Cat#39769 5mC Active Motif Cat#39649 Slc2a3 Proteintech Cat#20403-1-AP Pkm CST Cat#4053T SSEA-1 R&D Cat#MAB2155 Rpn1 (PSMD2) Santa Cruz Cat#sc-271775 Rpn2 (PSMD1) Santa Cruz Cat#sc-166038 Rpn9 (PSMD13) Abclone Cat#A6956 Rpn10 (PSMD4) CST Cat#12441S Rpn11 (PSMD14) CST Cat#7662S Rpt3 (PSMC4) Enzo Cat#BML-PW8765 PSMA7 Abcam Cat#ab109378 PSMB5 CST Cat#12919S 20S Enzo Cat#BML-PW8195 g-tubulin Sigma Cat#T5326 b-actin Genscript Cat#A00702 Flag-beads Sigma Cat#A2220 Chemicals, Peptides, and Recombinant Proteins Lipofectamine 2000 Invitrogen Cat# 11668019 MG-132 MCE Cat#HY-13259 BTZ (Bortezomib) MCE Cat# HY-10227 Deposited Data Raw imaging data This paper https://data.mendeley.com/datasets/3d4zdm6bh7/9/ files/9fe70da6-6f9e-418a-9cc8-7b04756f5d7d/source %20data%2020200509.ppt?dl=1 Raw and analyzed data This paper GEO: GSE140239 Experimental Models: Cell Lines

Techniques: Western Blot, Mutagenesis

Journal: Cell systems

Article Title: Loss of TET2 affects proliferation and drug sensitivity through altered dynamics of cell-state transitions

doi: 10.1016/j.cels.2020.06.003

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PE Mouse anti-Human CD34 BD Biosciences 555822 PE-Cy5 Mouse anti-Human CD38 BD Biosciences 555461 Chemicals, Peptides, and Recombinant Proteins Cytosine Beta-D-Arabinofuranoside Sigma-Aldrich C6645 Disulfiram Sigma-Aldrich D2950000 Human IFN-g PeproTech 300-02 Critical Commercial Assays CellTiter-Glo 2.0 Cell Viability Assay Promega G9242 QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina Lexogen 0.15.24/96 MethoCult H4034 Optimum STEMCELL #04034 Deposited Data Raw and analyzed data This paper; Mendeley data doi: 10.17632/xmvz47rpg6.1 Epigenome analysis of leukemia stem, blast and normal hematopoietic stem/progenitor cells Jung et al., 2015 ; GEO {"type":"entrez-geo","attrs":{"text":"GSE63409","term_id":"63409"}} GSE63409 Experimental Models: Cell Lines Human male: KG-1 ATCC CCL-246; RRID: CVCL_0374 Human male: THP-1 ATCC TIB-202; RRID: CVCL_0006 Oligonucleotides Primer HOXA5-F: TCTCGTTGCCCTAATTCATCTTTT McLaughlin-Drubin et al., 2011 N/A Primer HOXA5-R: CATTCAGGACAAAGAGATGAACAGA McLaughlin-Drubin et al., 2011 N/A Primer CD38-F: CACCAAGCGCTTTCCCGAGACC This paper N/A Primer CD38-R: GAGAGGCCCCTCCAGTGCAGAA This paper N/A Primer CORO1A-F: GTGGTCCGCTCCAGCAAGTTCC This paper N/A Primer CORO1A-R: CAGACCGTGGGCGCATTCTTGT This paper N/A Primer ITGAM-F: CTCCGTGGACGTGGACAGCAAC This paper N/A Primer ITGAM-R: AATGGCCACGTCCGTCAGCTTG This paper N/A Primer TAL1-F: GGGAGCCGGATGCCTTCCCTAT This paper N/A Primer TAL1-R: ACTTCATGGCCAGGCGGAGGAT This paper N/A Recombinant DNA pSpCas9(BB)-2A-Puro (PX459) V2.0 Addgene #62988 Software and Algorithms Code to generate all figures This paper; Mendeley data doi: 10.17632/xmvz47rpg6.1 Code pertaining to model This paper; GitHub https://github.com/AltschulerWu-Lab/tet2-dynamics DNA methylation age calculator Horvath, 2013 https://horvath.genetics.ucla.edu/html/dnamage/ R R Core Team, 2019 https://www.R-project.org MATLAB R2019a https://www.mathworks.com Open in a separate window KEY RESOURCES TABLE TET2 knockout in human AML cell lines increases stem-like signatures TET2 KO cells have altered dynamics between stem-like/differentiated states Altered cell-state switching dynamics provides fitness advantage in and out of drug

Techniques: Recombinant, Viability Assay, Software, DNA Methylation Assay